The central dogma is the classic sequence of events :

DNA produces RNA by transcription and RNA produces proteins ( structural proteins and Enzymes ) by translation .

Transcription: making of RNA (taking the information of DNA and copying the information to (transitional form) RNA which is unstable.

Translation: is the act of synthesizing a protein from the information in the RNA.

Against central dogma:

-Enzymes can be also certain forms of RNA.

-Now we can take RNA and make DNA from that.

-There are enzymes that can make RNA from RNA.

We will begin by transcription in prokaryotes.Typically in prokaryotes the transcription produces an RNA that encodes for more than one protein. Transcription starts at a promoter and make RNA at the same direction that DNA polymerase do for DNA (5’→3’) direction. RNA polymerase which recognizes promoter and does transcription (promoter is defined the site that bound by RNA polymerase and where transcription starts).

There are 2 parts to a promoter : there are so called -10 sequences and so called -35 sequences. What the -10 and -35 refer to is the distance in base pairs from the first base of DNA that is copied into RNA.These sequences  are highly characteristic of all genes in the case of -10 of the classes and the genes on the -35 sequences.

The -35 sequence is recognized by a protein (a family of proteins referred to) as sigma factors, these are regulatory proteins. Bacterial RNA polymerases are formed by 4 different subunits (2 copies of  big subunits called α and copies of β and β’) ⇒ α2ββ’.

 α2ββ’ is the holoenzyme and then σ factor is a regulatory subunit and comes in many varieties. There are many σ factors ,the key thing with σ  is that they are specific to particular promoters ,examples :

1)Heatshok

2) sporulation

There are many  factors, the key thing with  factors is that they are specific to particular promoters.

Differences between DNA and RNA :

1)2’ OH is special for RNA

DNA is deoxy. This OH group makes RNA unstable and vulnerable by enzymes or bases or different kinds of biophysical conditions. So RNA is designed to be unstable. Why RNA must be unstable (the earliest forms of life used RNA as a genetic material). Why we use an unstable molecule? probably it’s for the control of gene expression.

2) uracyl instead of thymidine

3) no primer required for the synthesis of RNA from RNA

4) synthesized in 5’→3’ direction (the chemistry involved is identical to DNA polymerase) :Initiation-elongation-termination

Step 1 :closed promoter complex

Step 2: formation of open promoter complex which is 17 bases pairs (normally there are 10 bases pairs by turn of helix) So 17 is almost 2 turns of helix in this situation, RNA polymerase start to synthesize RNA.

How we can confirm that? by DNA foot printing….

The post Chapter 8 : TRANSCRIPTION appeared first on BORZUYA UNIVERSITY.

Probability spaces: Sample space S, Probability measure P

Σ p(si) = 1        si<1   Event E is a subset of S,  so:  p(E) = Σ (ps)             S<E

Definition:  events A  and  B are  independent so  P(A ∩ B)=P(A) P(B), We  can extend  this to more than 2 subsets: A,B,C S , A,B,C=events, =are mutually independent that means A and B are independents, A and C are independents and B and C are independents:

P(A∩B)=P(A) P(B)      P(A∩C)=P(A) P(C)          P(B∩C)=P(B) P(C)              P(A∩B∩C)=P(A) P(B) P(C)

For more than 3 sets ,We can generalize this : p {A1∩A2∩A3∩A4∩A5∩…….}=  P(A1) P(A2) P(A3)P(A4)p(A5) ………

Conditional probability :

P(A\B) =  p(A∩B)/p(B),      Note: if A and B are independent then P(A\B) =P(A) because  P(A)p(B)/p(B)= p(A)

Total Probability rule

Suppose {A1,A2,A3,A4,…….An ) is a partition of S, that means these are subsets which together they form all of S (without overlap).Suppose B is an event in S. Then the probability of B equals the sum:P(B) =Σ p(B\Ai) p(Ai)

Proof: B=(B∩A1 )U (B∩A2 )…….. U(B∩An) .This is a disjoint union so:

P(B)=P(B∩A1 )+P(B∩A2 )+………..+P(B∩An )= P  P(B\A1 )PA1 +P(B\A2)PA2 …………P(B\An)  P An

Ex: does it rain more on week-ends? After a year of observation, we find that the probability of rain on a work day (W) is represented by 0,2.

Let’s also suppose that the probability of rain on a week-end day (H) is 0,3. With this we can probably say that it is more likely to rain on a day of weekend than the ordinary day.

Question: What is the overall probability of rain on a random day?

This question is usefull to introduce the tree diagram

What is the probability of rain? Total Probability:P(R)=P(R\W)  P(W)+P(R\H) P(H)  =0,2 X5/7 +0,3X2/7 =0,2286

Bayes Rule

Recall that P(A/B)  is not symmetric so  P(A/B) ≠ P(B/A)  ,  Bayes rule:

If 〈 A1,A2,A3,A4,A5……An〉 is a partition of S and B ≤ S (an event), then for any j,  the P(Aj/B)= P(B/Aj) P(Aj)

Proof:        P(Aj/B)=  P(Aj∩B)/p(B)

                   p(B/Aj)=  P(Aj∩B)/p(Aj)

                  So :   P( Aj/B) = P(B/Aj)p(Aj)/p(B)

                  and in general : P(Aj/B) = P(B/Aj)P(Aj)/ ∑P(B/Ai)P(Ai)

Let’s look to the situation of raining day. Suppose on a certain day it rains and we are intersected to know, what’s the probability that happens to be a week-end day ? Well according to the Bayes Rule

P (H/R)= P(R/H)P(H)/P(R)  = p(R/H)p(H)/p(R/W)p(W)+p(R/H)p(H)

= 0,3×2/7 divided by :0,2×5/7+0,3×2/7

Medical ex:

If you take a medical test is + but tests are not infaillable.A random person has a disease (D) or not ( ),Let’s suppose that we know that 3% of the population has this disease.The test is differing on actually if you have the disease. The test for D is 99%  sure of returning (+) if the persons has the disease and 98% sure of correctly returning (-) if they do not have it.Given Y what is the probability of D?

P

The post Chapter 4 : Bayes rule appeared first on BORZUYA UNIVERSITY.

Let’s count the number of words of length  K with n letters  ( repetition is  authorized): So  we have   A ,  B , B ,A ,  C ,   (K = 5    n= 3 )   generally   we  can wright (n exponant k ) words.

Now let’s count words from alphabet of k letters with repetion not allowed: K= 5  this kind of counting is called permutation of k objects :

A  B  C   D   E ( in this kind of counting each letter can be used only once So we will have 5 choices for the first letter , 4 for the second ,3 for the third ,2 for the forth , and 1 for the fifth .

K (K-1)(k-2)(k-3)(k-4) 1 =K!

Now let’s count words of length K from alphabet of n letters :N choices for the first letter,(N-1) choices for the second letter,(N-2 )choices for the third letter……(N-k)+1 choices for k th letter .That means n!/(n-k)! Words and without permutation we must divide by K!   so thefinal formula will be :   n!/(n-k)!k!   (that is the binomial coefficient)So for example for(3 exponant 5 )  we will have 5!/(5-3)!3! = 10   eg : from  A,B,C,D,E  we can have 10 possibilities:

{A,B,C}    {A,B,D}    {A,B,E}   {A,C,D}    {A,C,E}   { A,D,E}    {B,C,D}    {B,C,E}    {B,D,E}   {C,D,E}

                               BASIC DEFINITION OF PROBABILITY

Suppose a certain outcome o from N ways out of T possibilities. this is between 0 and 1    0 <  p <1

Ex:  Rolling a dice the Probability of getting a 3= 1/6  and  in a class of 28 peoples, 4 have red hair. Probability of red hair = 4/28 = 1/7

Ex: Probability of getting 3 successive Heads if you flip a coin 3 times = 1/2 x 1/2 x 1/2 = 1/8

Ex: Rolling tow dices the probability of getting 8 : well in this case the space of

Possibility is( total number is 36 and)  and outcomes giving 8 are 7 so the probability is  = P = 7/36

                                              RULES FOR PROBABILIOTY

Negation Rule: if the probability of an outcome o is P then the probability of O not occurring is (1-P).

Ex: Probability of rolling a 3 is 1/6 so that the probability of not rolling a 3 = 5/6

Multiplication Rule: if O1 and O2 are independent outcomes that means knowing that one does not influence the other. Then the probability of (O1 and O2) occurring together is the Prob(O1) x Prob(O2)

Ex: Wat´s the probability of drowing a red face card (Jack,Queen,King).

Red cards= hearts and diamonds . Wat`s the probability of getting a red card =2/4 and the Probability of getting a face card = 3/13 so the probability of drowing a red face card is 2/4 x 3/13 = 6/52 = 3/2

Addition Rule: if an outcome O can occur in two or more distinct possibles ways, then the probability of O is the  some   of the probabilities of each of individual ways of getting O.

Ex: Probability of getting  2 (3) if we roll a dice 5 times:Probability of getting a 3 in exactly first and forth rolles  is  the same  and not getting 3 in the second rol = 1-4/6 Now the probability of any of two positions   Then final probability =0,161

                                              POCKER CALCULATION

What is the probability of getting at least one pair from of 5 card hand (out of 52) .1-P=probability of getting all cards from different values 1   so   P=1-0,4929=1/2

Common birthdays: What´s the probability of ten people in the room at least two share birthday.Let´s find that  1-P=all ten have distinct birthday1-P=1    so P=1-0,883=0,117   and With 23 people P

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ThisisbetweenProbabilityofgettingEx:

The post Chapter 2: basic counting and probability appeared first on BORZUYA UNIVERSITY.

Definition:

Direct and deliberate modification of an organism’s genome.

Spotlights and topics in genetic engineering

Hybridization

Genetic tools

DNA analysis (electrophoresis and PCR)

Recombinant DNA technology

Gene therapy

Genome analysis  (fingerprinting and microarray)

HYBRIDIZATION

Allows identification of an unknown organism by looking at its DNA sequence. Hybridization use a DNA that binds complementary to the DNA of only one specific species according to base pair rules. If it Binds to the DNA of  an unknown organism we can identify the unknown one.

GENETIC TOOLS

Enzymes for dicing, splicing, reversing nucleic acids,allows the analysis of DNA. Enzymes that can be used as tools:

1)      Helicase

2)      Ligase

3)      Polymerase

4)      Reverse transcriptase

5)      Restriction endonucleases

Helicase:

Helicase, unwinds double stranded DNA and we can do it in test tube. The other possibility is heating  (also denature or unwinds the double stranded DNA).

Ligase:

seals gaps in DNA, so it seals two pieces of DNA together like a molecular glue.

Polymerase:

reads one strand of DNA and synthesize a complementary anti parallel strand. RNA polymerases reads DNA and makes complementary RNA.

Reverse transcriptase:

Reverse transcriptase makes a DNA copy from RNA. That’s a very unusual property and ability and the reason why it’s called reverse transcriptase is that it’s doing an opposite thing. Because transcription makes an RNA from DNA. In fact, this enzyme is not found in any cells, it is only found in a couple of viruses. Only a one small family of viruses, carries this enzyme, HIV is one of these viruses.

Restrictions endonucleases:

Recognizes specific DNA sequences and cut at that sequence. And they are extremely specific. There are a whole branch of different restriction endonucleases and each one cuts at a very specific DNA sequence (they are a molecular scissors for DNA). They are very specific. There are hundreds of restriction endonucleases but each one cut a specific site.

Imagine a sequence of DNA ,And we cut this with three different restriction endonucleases. We will have fragments.

If we have 2 enzymes with 2 cut sites, we will have three fragments.

After these scissions we can put them on gel electrophoresis,a method for separating DNA fragments according to their size:

How it works?

We take a gel and we put our samples at the top of gel and then we expose it to a charge (normally DNA has a negative charge because it has many phosphate groups)Therefor DNA begins to move towards the positive charge.How fast does it move depends on the size of the fragments?

Large fragments travel slowly, small fragments travel quickly, so it separates DNA fragments according to their size .

We will see an example ,checking a DNA sequence.We have a piece of DNA and we want to check the sequence…

5’TTC AAGCTTACGAAGGATTCGTATAC 3′

What we can do is we cut by restriction endonucleases and we know that  enzyme 1 cuts at AAGC.

And the enzyme 2 cuts at AGGA.So if we add these two different restriction endonucleases to this DNA we can predict how many fragments we expect to find:

We must find three fragments after the procedure (after complete digestion) but we also can know the size of each of those fragments.We know that this first fragment should be only three nucleotides long and the second fragment should be a five nucleotides long and the third fragment must be nine nucleotides long. Now how we can see the size of fragments?

We can run it on gel electrophoresis by putting our sample on the top of the gel and adding in, a standard mix, side by side .

How fast, each piece of DNA, moves depends on its size, smaller fragments move faster, larger fragments move more slowly.

3, 5, 9 nucleotides are the sizes that we can expect. So restriction endonucleases can be used as a way of checking a sequence.

Polymerase chain reaction (PCR) amplifies DNA:

PCR amplifies DNA: it is like a copy machine for DNA . The DNA polymerase chain reaction copies DNA and this is important because,we may have a DNA sample but we don’t have enough to analyze.For example we’re going to do gel electrophoresis,we will need a considerable amount of DNA to run those different tests.

How it works?

We add template DNA, DNA polymerase III, primers, nucleotide mix in a PCR tube and then we add our PCR tube to a PCR machine,and the PCR machine changes the temperature in order to copy DNA.

Here we have our template, PCR machine heat up to 94° (which is high enough to denature the DNA and the two strands separate).Then PCR machine switches to 55° (at which temperature primers will attach),Then the machine switches to 72° (at this temperature DNA polymerase attaches the primers and begins to copy them). by the end we will have 2 copies.

Then the machine goes back to 94° (denaturation) and 55° ( primer attachment) and 72° ( copy extension ), and the repetition over and over so PCR, copy and increase the  DNA synthesis by changing temperature.

Before PCR machine we were doing that by incubators (one at 94°, one at 55° and one 72°)

                                              Recap of DNA analysis methods

1) Enzymes can be used as molecular tools.

2) Gel electrophoresis : separates DNA fragments based on size.

3) Polymerase chain reaction: Amplifies DNA (make copies of the DNA) and Good primer design allows the isolation and amplification of a particular gene out of the entire genome

                 Using PCR to isolate and amplify a gene from the genome

Primers are designed to bind a specific place in the DNA according to complementary base-pair rules .Since DNA polymerase III, can only start DNA replication, where the primer is attached, the primer attachment site controls what part of DNA, is replicated by the PCR. By designing primers to bind by complementarity on each side of the gene of interest we can specify the PCR to isolate and amplify just that gene and nothing else

                                             Recombinant DNA technology

Transferring DNA from one organism to another, in this process, there are a genetic donor , a vector , a host.The vector, transfers the gene, from the donor to the host. There are different vectors, the most common vector used, is the plasmid (a small circular piece of DNA),the other possibility would be a virus, they can also transfer DNA from one organism to another.

An example of a cloning vector is pBR 322: This is a plasmid that is used currently
There are many plasmids but they all have some common factors :
1) All vectors must have an (ORI) which is a specific DNA sequence of 50 – 100 base pairs that must be present in a plasmid for it to replicate. Host-cell enzymes bind to ORI, initiating replication of the circular plasmid. Once DNA replication is initiated at ORI, it continues around the circular plasmid regardless of its nucleotide sequence . Thus any DNA sequence inserted into such a plasmid is replicated along with the rest of the plasmid DNA.

2)Plasmid also must have some sort of Promoter: where the gene can be transcribed.

3)Plasmid must also have a room for gene insertion. In other words it can’t be too large and it also should have a whole bunch at different place where we could cut the plasmid and insert our gene of interest.

4)Reporter gene : we must also have a reporter gene which inform us whether or not the gene is there.

Very common reporter gene would be antibiotic resistance genes so PTR322 carriers tetracycline resistance gene as well as an ampicillin resistance gene

In other words normally E-coli is killed by ampicillin or tetracyclin but if that E coli has PBR 322 inside of it it’s going to survive an ampicillin or tetracycllin.

Example:

If we want to move a gene for human insulin into E coli:the first step is to isolate an amplify your gene of interest.How are we going to isolate and amplify our gene of interest (which is the human insulin gene)?

We will do it by PCR. By designing correctly our primers, we can copy only the human insulin gene.

we take a plasmid like pTR 322, and we put your gene of interest (Human Insulin Gene) into the PBR 322 .We cut a hole in the plasmid by restriction endonuclease,then we seal the insulin gene  in the plasmid by ligase .

So, PCR ⇒restriction endonuclease ⇒ligase

Now, we have our plasmid with our gene of interest on it.Then, we put our cloning host E coli and our vector pTR 322 in the test tube and we will do the transformation.

Remember, that transformation is not a common event (it is not a very efficient process).What can we do to increase the efficiency of transformation?

What can we do? to increase that bacteria taking in that plasmid? We know that some chemical treatments and the electricity encourage the bacteria to take in the plasmid.

Remember that if we put all the bacteria in normal culture medium all bacteria will grow But if we put them in the medium with ampicillin or tetracycline, only the E coli’s having the plasmid will develope.

    Biochemical products of recombinant DNA technology

Enables the large scale manufacturing of life-saving hormones, enzymes and vaccines:

Insulin for diabetes

Human growth hormone for dwarfism

Erythropoietin for anemia

Factor 8 for hemophilia

HBV vaccine

Genetically modified organisms  

1) Recombinant microbes:

Microbes synthesizing a wide variety of proteins used in medicine, agriculture, industry, etc.

2) Transgenic plants:

Plants that synthesize vitamins, medicines or agriculturally important substances

Agrobacterium is interesting because it naturally transforms  plant cells. (it is part of it’s normal natural behavior).The particular plasmid that agrobacterium contains is Ti plasmid.

If an agrobacterium encounters a plant it pushes his plasmid into the plant cell, so it transforms the plant cell (this is a normal and natural behavior).Why the agrobacterium does that?

Because the Ti plasmid (tumor inducing plasmid), encodes all of the information, for making agro’s favorite food source. So, agrobacterium comes up to a plant cell, pushes his plasmid to the plant cell and the plant begins to produce the food that agro wants to eat. But, how it’s useful for us?
If we put our gene of interest on to the Ti plasmid and put the Ti plasmid into agro then agro will transmit that gene to the plant cells.
Let’s imagine that we will create a tomato plant that expresses human insulin, so our gene of interest is human insulin. All we have to do is isolate and amplify (by PCR) the human insulin gene from human genetic donor. By Good primer design we can copy only the human insulin gene. next we cut the TI plasmid by restriction endonucleases, and with the ligase we can seal the insulin gene on the plasmid.
All after is naturally done by agrobacterium.Agrobacterium easily infects all of the gross plants including potatoes, tomatoes, bananas………………

Transgenic animals:

Animals synthesizing medicines or providing models for human diseases

(cystic fibrosis is a disease of human and we can not study easily) ,so we must create a transgenic animal with the gene of cystic fibrosis.

Let’s see how we can create transgenic animals:

First, we collect embryos and culture them and then we inject our gene of interest in the embryo, and we hope that this DNA of this embryo will integrate the gene of interest into it’s genome. The success rate is not high.

And, then we inject this embryo to a female and then we will wait until a transgenic animal will born

What’s interesting?

1)      We can create animal models for human diseases

2)      We can create animals with humans genes for production  of hormones

And probably we can grow human organs by this model.

The post Chapter 1: Genetic engineering appeared first on BORZUYA UNIVERSITY.

A set is a collection of mathematical or every kind of elements  e.g   A = {1,2,3,4,6,Δ,a} .1,2,3,4,6,Δ,a  are called elements of the set A and the size of elements is the absolute value of A = !A! (that is the absolute avalue of  total number of elements) .In this case the size of A is 7

Operation on sets:

There is a kind of mathematical rules of sets:  ∩= Intersection,  U= union eg If A and B are sets  AUB = is the set of all X such that X is an element of A or X is an element of B  A∩B= is the set of all X such that X belongs to A and X belongs to B. Sometimes we can do a kind of venn diagrams to illustrate sets :Sometimes all sets belong to a universal set eg the universal set U then A complement is a set of X belonging to U such that X dose not belong to A

Laws of set operations :

A U (B ∩ C) = (A U B) ∩(A U C)

That means every thing in A plus every thing in the intersection of B and C

AUBUC = ¦A¦+¦B¦+¦C¦—¦( A∩B)¦—¦A∩C¦—¦B∩C¦+¦A∩ B∩ C¦

                                                                                                             Inclusion/Exclusion Inclusion/ Exclusion for n sets!

Ex. Uni  foot team has 11 students taking chemistry (C) ,12 students taking mathematics (M),12 students taking physics (P). If 7 take C and P, If 4 take M and P, If 5 take C and M, If 3 take all three, If 3 take none of these.Haw many are in the team?

so without any formulas we have 25(Number) in the union (total =25)

Partition of a set A:

the idea of partition is to subdivide a set in pieces

Def: a partition of the set A is a set of subsets

If C is a subset of B that means if X belongs to C then X belongs to B. the addition of subsets equals the original set

There are conditions to that : all the subsets of A must be  disjoint. so A1+A2+A3+…………………………..Ak= A

Ex :

Let’s flip a coin 3 times then the possible outcomes are 8 possibilities (TTT, TTH, THT, THH, HTT, HTH, HHT,HHH) .2×2×2 ( every time there are 2 possibilities) now lets consider a partition :

A0 :{TTT}      A1:{TTH,THT,HTT}    A2:{THH,HTH, HHT}      A3 :{HHH}

AK : set of outcomes with K heads , this is a partition of big set A

Functions:

Suppose that A and B are sets and f(A) that means inputs on element A are the outputs on element B associated with it .

We can define im ( f)={ b belonging to B } For each b we can define the inverse image (b)

The post Chapter 1: Probability ( basic review of sets) appeared first on BORZUYA UNIVERSITY.

Eukaryotes  : Fungi ,Protozoa

Prokaryotes : Bacteria,Archie

Because bacteria are most diverse collection of organisms, it is very hard to say something universally about bacteria. So, this discussion can be inexact concerning all bacteria.

Generally, bacteria are small microorganismes (eg: E coli measures approximately 0,5 in width by 2 μm in length). They have one chromosome, generally circular DNA molecule, but they are very diverse.

Bacteria can be represented schematically:

The center is the nucleoid which is a single chromosome in all bacteria surrounded by cytoplasm, there is an inner membrane and a rigid cell wall.

And some bacteria contain another membrane on the outside (50%) = outer membrane (gram stain is on outer membrane).

Bacteria are divided by fission: for ex E coli is divided every 20’  ⇒1000 (10 generations) in 200′ , 1000000 (20 générations) in 400′ ……….

Bacteria has one DNA molecule and it is typically a circle. And in every case, there is a point on that molecule, where the DNA replication initiates. it is called origin of replication and when it is initiated it progresses in two directions and go around to meet each other at the bottom and at that moment the chromosome is completely replicated.

The speed of DNA polymerase of E coli is 1000 base pairs/sec ,The error rate is 1 Base/generation.

Now, the E coli DNA has 4639221 base pairs ,How long E coli takes to replicate his chromosome? = 70 minutes .It divides par 20 minutes but replicates its DNA per 70 minutes!! How it is possible?? Part of the response is bacteriophage

The DNA is really pressurized in the head of phage ,(Pressure = 6 mega Pascale = 60 atmosphere  remember that with a champagne bottle after shaking there is 6 atmospheres).

Phage life style

The second mechanism is shown by lambda phage ,When lambda penetrates, it will see the conditions inside the bacteria; if conditions are bad so it integrates bacterial DNA and stays there until the conditions change.

So, the decision making between giving lytic or lysogenic, is probably the most well understood, of molecular switches in all of biology

In bacteria there is three kinds of exchange of DNA

1) Transformation

What haemophilus will do in order to explore evolutionary space, is it take up DNA from a solution : if that DNA comes from another haemophilus (there are changes in DNA and some are advantageous but some are not).

When it takes DNA from outside it see if it is advantageous or not so integrates or not.

What haemophilus has on it’s surface is a receptor protein that recognizes 11 base pairs sequences of DNA and this is common in haemophilus chromosomes and is uncommon an other chromosomes.

And how it can knows to take a good DNA and not a bad one? Normally, the 11 pairs are different from the phage’ s chromosomes, but sometimes they are the same.The second protection is: restrication-modification system. Each bacteria has an enzyme in it that recognizes a particular sequence of DNA and simply clives that sequence: 4 bases/sequences, 5 bases pairs/sequence, 6 or 8 bases pairs /sequences

CGATCG            GCTAGC

When DNA is methylated (CH3 ) the enzyme doEs not cut but otherwise  it  cut, so if it comes from haemophilus it is methylated, but in viruses and phages it is not.

2)      Conjugation

Plasmids is small circular DNA molécules ,F= fertility plasmid .How doses that work?

3)      Transduction:

The post Chapter 2 : Microbial genetics and evolution appeared first on BORZUYA UNIVERSITY.

What are Mendel’s laws?

1)Segregation:If we have a gene type Pp the probability of P an p is 50%. This separation of genes is called segregation. (random chance of having P or p)

2) Independent assortment: That means the separation of genotypes do not influence each other, so they are independent (But sometimes it is not true because two genes are at same chromosomes).

Problems:

1) A coin is flipped 4 times and comes up heads each time. What is the probability that the next coin flip will come up heads?

2) Classify the following as heterozygous or homozygous: RR, Rr, YY, Yy RR

3)What is the phenotype of the following Yy, Rr, yy, YyRr

4)What is the probability of Rr X Rr producing wrinkled seeds?

5)What is the probability of Yy X yy producing green seeds?

6)What is the probability that Rr Yy X RR Yy would produce Rr Yy?

                                               Punnett square

The Punnett square is often over used as just a quick way to solve genetic problems without really understanding it. What’s ‘going on with the genetics? The two sides of Punnett square represent the alternatives after meiosis. In other words you have a brunch of genes and you give half of those genes to a sperm or an egg. And that happens trough meiosis and so the organization of those gametes. In this case it’s just a monohybrid cross, are going to be on either side of this, just like a flip of a coin. This would be for one parent. And then this would be the other parent on the other side. And so what are in boxes on a Punnett square stand for? They simply stand for all the alternatives that could occur if we had mating between each of these different gametes. And so let’s get to some examples and hopefully that will help. So, we are going to start with a monohybrid cross. A monohybrid cross is simply a cross that is looking at one trait. And so let’s say were crossing purple flowers that are homozygous purple with those that are homozygous white flowers. In other words this is the dominant trait and the other one is a recessive trait. And so if you look, at the parents what you Want to do first of all, is figure out what are the possible gametes. That could be produced in meiosis. What does it mean? It can only give one thing, it can only give a big P or that dominant allele. And so if you’re doing a problem like this you don’t need a big Punnett square. The other parent is pp and he can give only a p because the p’s are the same.

We see that there are two possibilities for each parent. And we have to show both of those possible gametes of meiosis. There is a 1 to 2 genotypic ratio PP,pp-homo and Pp,Pp-hetero     But a 3 to 1 ratio for phenotype, that means three purple to 1 white. Now let’s see an incomplete  dominance; a snapdragon would be an example of that. A snapdragon has two genes; if it has a red gene and a white gene, then it’s going to be pink. And so this one, in this case we will have 1 to 2 ratio in genotype but also in phenotype (co dominance or incomplete dominance)

And now we will try with a sex linked chromosomes or a x linked chromosomes. Ex: is a color blindness gene and the father is normal.

She is not color blind because she has an efficient gene and she is only carrier. So we have a color blind male and a carrier female, a normal female and a normal male.

Now let’s have a look  on dihybrid cross  Rr Yy   Rr Yy,  R= round pea seeds Y=yellow seeds If it is recessive that stands for wrinkled and if it is a little y that stands for green and so we are looking at a dihybrid, so that means two traits. We’re looking at seed’s shape (round or wrinkled). And seed’s color, yellow or green. So now we have to do a dihybrid cross. And so the tendency is we look at this parent. We can see that there are four letters and there are four boxes and then you just simply write them out. Big R  little r, big Y little y and then you get a weird  answer and you don’t know what to do with it. Rr Yy  What are possibility of gametes? RY, Ry, rY, ry We can do the same with other parent

These nine will be round and yellow, because they are dominant and when we have dominant genotype the phenotype will be the same (round and yellow); four will be (wrinkled and yellow) and one will be green and wrinkled.

Human genetic disorders: Human genetic disorders caused by non-disjunction: Trisomy 21 (Down’s syndrome) ,klinefelters’s syndrome , Xxx metafemals syndrome. Can we survive with only one x or y chromosome?  so we will study specific diseases

1) Sickle cell anemia which is a genetic blood disorder (a base substation in a single point). It causes red blood cells to be misshapen. This abnormality is frequent in Africa and Mediterranean regions and in south and central America (where malaria have been prevalent) The alleles for this trait exhibit co-dominance Bn=normal Bs=sickle

With sickle trait the people have no abnormal episode and it is a good defense against malaria.

2) Huntington’s disease, a genetic disorder du to an abnormal gene on chromosome n° 4. The faulty gene that causes Huntington’s disease is found ( a normal copy of the gene produces huntingtin, a protein. The faulty gene is larger than it should be and produces a larger form of huntingtin)

Some of our brain cells are sensitive to the larger form of huntingtin – it undermines their function and eventually destroys them. Scientists are not sure exactly how this happens. Scientists have figured out why a faulty protein accumulates in cells everywhere in the bodies of people with Huntington’s disease, but only kills cells in the part of the brain that controls movement, causing negligible damage to tissues elsewhere. Huntington disease is unique because it is a dominant gene (dominant genes don’t have to be common in fact and Huntington is really rare ) Why this disease is interesting? If the gene is dominant and the patient  dye, how can he passe the gene to the others? The Huntington disease dose not become symptomatique until age 40; so the patient will have time to passe the gene.

3) Hemophilia: The gene for Haemophilia is carried on the X sex chromosome (females are XX; males are XY). A man with Haemophilia passes the faulty gene to his daughters who then carry this gene and may pass the condition onto their sons. A man with Haemophilia does not pass the faulty gene onto his sons because they receive a copy of his Y chromosome (their X chromosome comes from the mother).

Men are affected because the faulty gene on their X chromosome lacks the necessary instructions to produce the clotting factor which causes blood to clot. Women are usually unaffected because they have two X chromosomes and the working copy of the gene tends to override the faulty copy. However, about a third of female carriers have low clotting factor levels and may be mildly affected.

If a carrier mother decides to have children, all her daughters have a 50% (1 in 2) chance of being a carrier. This depends on whether they receive the X chromosome containing the faulty or the working gene. Sons also have a 50% (1 in 2) chance of inheriting the faulty or the working gene. If they inherit the faulty gene, they will have Haemophilia as they do not have a second X chromosome to override the faulty copy.

About 30% of people with the condition have no family history of Haemophilia. They are probably affected because of a spontaneous genetic mutation which took place in the egg or sperm before fertilisation.

The post Chapter 1: Mendelian genetics appeared first on BORZUYA UNIVERSITY.

Key components of this machinery are:

1)      Spindle: is made of microtubules or cytoskeleton, centrioles, kinetochores and contractile ring.

2)      And this machinery is controlled by a control system which integrates signals from growth and division.

These signals are:

a)      Cell division kinases (CDK)

b)      Each kinase has an activity that is controlled by a cycline (regulatory subunit of CDK) and the activity

of these 2 systems is controlled by a third system which is;

c)        regulated destruction mechanism.

Cell division is highly regulated:

The cells are dividing by 8 minutes (but neurons by 100 years) but the typical cells (eg liver cells) divides

1/year, and the cells of gut are dividing 1/day .

Cell division

1)      Cell division requires partitioning of organelles for this there is 3 stratégies :

A)     Abundant organelles like ribosomes peroxisomes ( 1/2 goes in one side and 1/2 to the other side)

B)      Mitochondria chloroplast: these are ancient captured bacterias and conserves their own mechanism

of division .So chloroplast and mitochondria split during cell division .

C)       Golgi and endoplastic reticulum becomes small vesicles and then after cell division they come back

together and reform Golgi and ER

D)     Centrosome = centriole is the poorly understood in eukaryotes cells.

Centriole template his own replication so we need a centriole to make a new centriole (centriole play a key

role in mitotic spindle apparatus and centrioles are structures, that DNA contemplate his replication.

G1 and G0: G1 is the phase in  which the cell ask herself  “am I big enough to divide” are there enough food?

There are also the + or – factors from other cells or the environment.And if the final decision is not

to divide the cell goes back to  G0 phase where there is no division.

S phase : the phase in which  nuclear DNA replication and mitochondrial DNA replication  occurs .

G2: another decision making phase is G2: cell verify if every single genome has been replicated or not. If it has not, there is a mechanism that ask the cell to halt in G2 until the last nucleotide could be replicated. G2 will be prolonged until the cell has all needed to go to M.Another control point is to see if each kinetochore archived bipolar spindle attachment.

M: and finally mitosis  happens:

Chromosomes consist of one DNA molecule and the proteins associated with that and we must not underestimate the importance of the proteins and the mass of  proteins associated with the DNA (their mass exceeds the mass of DNA).

There are critical landmarks on the chromosomes and the most important is the centromere. The centromere is the point at which the chromosome attaches to the spindle apparatus to allow chromosome segregation that is it’s only function; but at this point there is a very complete protein structure (fifty different proteins called connect cord. So, the connect cord is the structure that assembles at this point to archive protein segregation).

We know that there are the origin of replication on DNA, result in eukaryote cells there are multiple origins of replication.

At the very end of chromosomes, there are specialized structures called telomerase.

Telomerase the enzyme which intervene in the replication of telomere.

Chromosomes have lots of genes collectively our chromosomes.

How 22250 genes which make proteins as well as RNA

Ploidy = number of sets of chromosomes

Haploid = organisms who have one set of chromosomes

Diploid = organisms who have two sets of chromosomes

Triploid = organism who have three sets of chromosomes

Tetraploid = organism who have four sets of chromosomes

Hexaploid = organism who have six sets of chromosomes

Octaploid = organism who have eight sets of chromosomes

The letter N is used to refer to number of chromosome haploid cell.

So, for humans and potatoes N=23 and as we are diploid, so we have 2 x 23 chromosomes

C value refers to the contact of DNA (amount of DNA in the cell)

N is a discontinuous functions but the C value is the continuous function.

So, the amount of DNA in a diploid nucleons is 2 C in G1 and the amount of C in G2=4C

But in G2 the number of chromosomes dose not change.

How do we measure DNA content?

We can do that because of amazing machine

FACS= fluorescent activated cell sorter or cell scanner

The fluorescent dye that steins DNA but it stains DNA proportionately to the DNA reserve

The post Chapter 3: eukaryote cell division appeared first on BORZUYA UNIVERSITY.

Cellular membranes are fluid mosaics of lipids and proteins

– Phospholipids are the most abundant lipid in the plasma membrane

-Phospholipids are amphipathic molecules, containing hydrophobic and hydrophilic regions.

-The fluid mosaic model states that a membrane is a fluid structure whith a “mosaic” of various proteins embedded in it.

Freeze fracture experiments

– Freeze fracture studies of the plasma membrane supported the fluid mosaic model.

– Freeze fracture is a specialized preparation technique that splits a membrane along the middle of the phosphatide bilayer.

The fluidity of membranes

– Phospholipids in the plasma membrane can move whithin the bilayer

– Most of the lipids and some proteins drift laterally.

– Rarely does a molecule flip-flop transversely across the membrane

Membrane proteins and their functions:

-Peripheral proteins are bound to  the surface of the membrane

– Integral proteins penetrate the hydrophobic core

-Integral proteins that span the membrane are called transmembrane proteins.

-The hydrophobic regions of an integral proteins consist of one or more stretches of nonpolar amino acids.

Six major functions of membrane proteins:

– Transport

– Enzymatic activity

– Signal transduction

– Cell-cell recognition

– Intercellular joining

– Attachment to the cytoskeleton and extra cellular matrix

Synthesis and sidedness of membranes

– Membranes have a distinct inside and outside faces

-The asymmetrical distribution of proteins, lipids and associated carbohydrates in the plasma membrane is determined when the membrane is built by the ER and Golgi apparatus.

Membrane structure results in selective permeability

–  A cell must exchange materials with its surrounding, a process controlled by the plasma membrane

– Plasma membranes are selectively permeable, regulating the cell’s molecular traffic

– Hydrophobic (nonpolar) molecules such as hydrocarbons, can  dissolve in the lipid bilayer and pass through the membrane rapidly

– Polar molecules such as sugars do not cross the membrane easily

Passive transport: diffusion across a membrane with no energy investment

1)Diffusion is the tendency for molecules to speed out evenly into the available space.

2)Although each molecule moves randomly, diffusion of a population of molecules may exhibit a net movement in one direction

3) At dynamic equilibrium, as many molecules cross one way as cross in the other direction.

Effects of osmosis on water balance

1) Osmosis is the diffusions of water across a selectively permeable membrane.

2)Water diffuses across a membrane from the region of lower solute concentration to the region of higher solute concentration.

Water balance of cells without walls. Tonicity is the ability of a solution to cause a cell to gain or lose water.

Isotonic solution: solute concentration is the same as that inside the cell, no net water movement across the plasma membrane

Hypertonic solution: solute concentrations greater than that inside the cell; cell loses water

Hypotonic solution: solute concentration is less than that inside the cell; cell gains water.

Transport proteins: Transport proteins allow passage of hydrophilic substances across the membrane.

Some transport proteins, called channel proteins have a hydrophilic channel that certain molecules or ions can use as a tunnel.

Channel proteins called Aquaporin facilitate the passage of water.

Facilitated diffusion, passive transport aided by proteins, facilitated diffusion : transport proteins speed the passive movement of molecules across the plasma membrane.

Channel proteins provide corridors that allow a specific molecule or ion to cross the membrane

Channel proteins include:

Aquaporin, to facilitate diffusion of water ,Ion channels that open or close in response to a stimulus (gated channels)

Active transport uses energy to move solutes against their gradients:Facilitate diffusion is still passive because the solute moves down its concentration gradient.Some transport proteins however can move solutes against their concentration gradient.Active transport moves substances against their concentration gradient.Active transport requires energy usually in the form of ATP.Active transport is performed by specific proteins embedded in the membranes.

Ion pumps maintain membrane potential:Membrane potential is the voltage difference across a membrane. Voltage is created by differences in the distributions of positive and negative ions.

Two combined forces collectively called the electrochemical gradient, drive diffusion of ions across a membrane. A chemical force (the ion’s content ratio gradient),An electrical force (the effect of the membrane potential on the ion’s movement) An electro genic pump is a transport protein that generates voltage across a membrane. The sodium potassium pump is the major electro genic pump of animal cells.The main electro genic pump of plants, fungi and bacteria is a proton pump.µ

Bulk transport by exocytosis and endocytosis

Small molecules and water enter or leave the cell through the lipid bilayer or by transport proteins

Large molecules, such as polysaccharides and proteins, cross the membrane in bulk via vesicles.

Bulk transport requires energy.

In exocytosis transport vesicles migrate to the membrane, fuse with it and release their contents.

In endocytosis the cell takes in macromolecules by forming vesicles from the plasma membrane.

The post Chapter 2:the structure of biological membranes appeared first on BORZUYA UNIVERSITY.

–          The cell is the simplest collection of matter that can live (reproduce)

–          Cell structure is correlated to cellular function.

–          All cells are related by their descent from earlier cells

Viruses are considered not to live because there reproduction depends on other organisms

How do we study cells?

Normally cells are too small to be seen by eye so we must use micros copes and other techniques like biochemistry to study them

         Light microscope :  the best magnification 1/1000

The quality of the image depends on 3 things

1)      Magnification : rates of object’s image size to its real size

2)      Resolution : basically it means the clarity of the image (the minimum size visible)

3)      Contrast

Electron microscopy

–          Two basic types of electron microscopes are used to study subcellular structures

1)      Scanning electron microscopes focus a beam of electrons outs the surface of a specimen, providing images that look there dimensional.

2)      Transmission electron microscopes :

Focus a beam of electrons through a specimen (TEMS), there kind of electron microscope is used to study the internal structure of cells.

Example of scanning and transmission electron microscopy

The other technique is Biochemistry

Cell fractionation

–          Cell fractionation on takes cells apart and separation the major organelles from one anther

–          Ultra centrifuges fractional cells into their component parts.

–          Cell fractionation enables scientists to determine the functions of organs

–          Biochemistry and cytology help correlate cell function with structure.

Biochemistry

–          Cell fractionation takes cells apart and separates the major organelles from the another

–          Ultra centrifuges : fractional cells into their component parts

–          Cell fractionation enables scientists to determine the functions of organelles

–          Biochemistry and cytology helps correlate cell function with structure

Comparing prokaryotic and eukaryotic

–          Basic features of all cells

.) Plasma membrane

.) Semifluid substance cells cytosol

.) Chromosomes (carry genes)

.) Ribosomes (make proteins)

–          The structural and functional unit of every organism is one of two types of cells : prokaryotic or eukaryotic

–          Only organisms of the domains bacteria and arches

–           consist of prokaryotic cells

–          Protests fungi, animals and plants all consist t of eukaryotic cells.

Prokaryotic cells

–          No nucleus

–          DNA is an unbound region called the nucleoid

–          No membrane bound organ cells

–          Cytoplasm bound by the plasma membrane

Eukaryotic cells

–          DNA is a nucleus that is bounded by a membranous nuclear envelope

–          Cytoplasm in the region between the plasma membrane and nucleus

–          Eukaryotic cells are generally much large than prokaryotic cells

In the center of nucleus there is a concentrated region called the nucleolus and this is where ribosomal RNA is made and processed it’s also the site where there’s a lot of organization of other RNA protein complexes that have to be assembled in the nucleus.

And we see the endoplasm reticulum and outside of that is the Golgi and mitochondria and centrosome.

Centrosome is the region where doing cell division the chromosomal DNA comes together and we have also lysosomes, peroxisomes and in the outside of the cell we see microvilli protruding from the cell.

The nucleus :information central

–          The nucleus contains most of the cell’s genes and is usually the most consequence…. organelle.

–          The nuclear envelope encloses the nucleus, separating it from the cytoplasm

–          The nuclear membrane is a double membrane each membrane consists of a lipid bilayer.

–          Pores regulate the entry and exit of molecules from the nucleus.

–          The shape of the nucleus is maintained by the nuclear lamina which is composed of protein.

Ribosomes: protein factories

 –          Ribosome are particles made of ribosomal RNA and proteins.

–          Ribosomes carry out protein synthesis in two locations:

–          In the cytosol (free ribosomes)

–          On the outside of the endoplasmic reticulum on the nuclear envelope (band ribosomes)

The endomembrane system regulates protein traffic and performs metabolic functions in the cell.

Ribosome is composed of large submit and small submit and between the 2 submits RNA in the middle and proteins going out in the middle part

The endomembrane system regulates protein traffic and performs metabolic function in the cell.

–          Components of the endomembrane system :

–          Nuclear envelop

–          Endoplasmic reticulum

–          Golgi apparatus

–          Lysosomes

–          Vacuoles

–          Plasma membrane

These components are either continuous or connected via transfer by vesicles.

The endoplasmic reticulum: biosynthetic factory

–          The endoplasmic reticulum (ER) accounts for more than half of the total membrane in many eukaryotic cells.

–          The ER membrane is continuous with the nuclear envelope.

–          There are two destinct regions of ER.

.) Smooth ER which lacks ribosomes

.) Rough ER with ribosomes studding its surface.

Functions of smooth ER and rough ER :

The smooth ER:

–          Synthesize lipids.

–          Metabolizes carbohydrates

–          Detoxifies poison

–          Stores calcium

The rough ER:

–          Has bound ribosomes, which secret glycoproteins (protein covalently bonded to carbohydrates )

–          Distributes transport vesicles proteins surrounded by membrane

–          Is a membrane factory for the cell

The Golgi apparatus: shipping and receiving center

–          The Golgi apparatus consists of flattened membranous sacs called cisternae

–          Functions of Golgi apparatus:

.) Modifies products of the ER

.) Manufactures certain macromolecules

.) Sorts and packages molecules into transport vesicles

Lysosomes: digestive compartments

–          Some types of cells can engulf other cells by phagocytosis this forms  a food vacuole

–          A  lysosome fuses with the food vacuole and digests the molecules.

–          Lysosomes also use enzymes to recycle the cell’ s over organelles and macromolecules a process called autophagy.

Mitochondria and chloroplasts change energy from one form to another.

–          Mitochondria are the sites of cellular respiration a metabolic process that generates ATP.

–          Chloroplasts, found in plants and algae are the sites of photosynthesis.

–          Peroxisomes are oxidative organelles.

–          Mitochondria and chloroplasts:

.) are not part of the endomembrane system

.) have a double membrane

.) have proteins made by free ribosomes.

.) contain their own DAN

Mitochondria: chemical energy conversion

–          Mitochondria are in nearly all eukaryotic cells

–          They have a smooth outer membrane and an inner membrane folded into cristae.

–          The inner membrane creates two compartments: inter membrane space and mitochondrial matrix.

–          Some metabolic steps of cellular respiration are catalyzed in the mitochondrial matrix

–          Cristae present a large surface area for enzymes that synthesize ATP

Chloroplasts: capture of light energy

–          The chloroplast is a member of a family of plant organelles called plastids

–          Chloroplasts contain the green pigment chlorophyll, as well as enzymes and other molecules that function in photosynthesis

–          Chloroplasts are found in leaves and there green organs of plants and in algae.

Peroxisomes: oxidation

–          Peroxisomes are specialized metabolic compartments bonded by a single membrane

–          Peroxisomes produce hydrogen peroxide and convert it to water.

–          Oxygen is used to break down different types of molecules

The post Chapter 1: the fundamental units of life appeared first on BORZUYA UNIVERSITY.